Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 6370024
End position: 6370048
Length: 25

DNA sequence
>NC_013929, from 6370024 to 6370048 (25 bp); Streptomyces scabiei 87.22 GCCGGGCAGGGTCGGGACGGGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6369878-6370963	Sequence	SCAB_57211 - oxidoreductase (Protein is coded in complementary strand; from 6370963 to 6369878)