Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 6395442
End position: 6395477
Length: 36

DNA sequence
>NC_013929, from 6395442 to 6395477 (36 bp); Streptomyces scabiei 87.22 GCGGGGTGTCGGTCGGGGTGTCGGTCGGGGTGTCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6394664-6395485	Sequence	SCAB_57431 - ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 6395485 to 6394664)
ORF... 6395475-6396125	Sequence	SCAB_57441 - ABC transporter (Protein is coded in complementary strand; from 6396125 to 6395475)