Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 6415936
End position: 6415962
Length: 27

DNA sequence
>NC_013929, from 6415936 to 6415962 (27 bp); Streptomyces scabiei 87.22 CGGACGGGGCGGCCGGGGCGGCCGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6415710-6416273	Sequence	SCAB_57631 - hypothetical protein (Protein is coded in complementary strand; from 6416273 to 6415710)