Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 6426107
End position: 6426130
Length: 24

DNA sequence
>NC_013929, from 6426107 to 6426130 (24 bp); Streptomyces scabiei 87.22 CGCCGGCGCCGGCGCCAGCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6426105-6427547	Sequence	SCAB_57721 - beta-glucosidase (Protein is coded in complementary strand; from 6427547 to 6426105)