Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 6465965
End position: 6466009
Length: 45

DNA sequence
>NC_013929, from 6465965 to 6466009 (45 bp); Streptomyces scabiei 87.22 CGGACACCGCGGGGTCGGACACCGCGGGGACGGGGACCGCCGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6464368-6466035	Sequence	SCAB_58091 - regulatory protein (Protein is coded in complementary strand; from 6466035 to 6464368)