Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 6491406
End position: 6491429
Length: 24

DNA sequence
>NC_013929, from 6491406 to 6491429 (24 bp); Streptomyces scabiei 87.22 ACCCGCACCCGAACACGCACCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 6491430-6492359	Sequence	SCAB_58291 - hypothetical protein (Protein is coded in complementary strand; from 6492359 to 6491430)