Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 6565591
End position: 6565614
Length: 24

DNA sequence
>NC_013929, from 6565591 to 6565614 (24 bp); Streptomyces scabiei 87.22 GCCGTTGCCGTTCCCGTTGCCGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6565565-6565993	Sequence	SCAB_58991 - hypothetical protein (Protein is coded in complementary strand; from 6565993 to 6565565)