Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 6609107
End position: 6609151
Length: 45

DNA sequence
>NC_013929, from 6609107 to 6609151 (45 bp); Streptomyces scabiei 87.22 TCTTCGCCCGCCGGGGCCTCGCCCGCGGGGTCTTCGGCCGCCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6606545-6609172	Sequence	SCAB_59401 - serine/threonine protein kinase (Protein is coded in complementary strand; from 6609172 to 6606545)