Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 66540
End position: 66572
Length: 33

DNA sequence
>NC_013929, from 66540 to 66572 (33 bp); Streptomyces scabiei 87.22 CACCTCCCCTGTACCTCGCCTGCATCTCCCCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 66571-67704	Sequence	SCAB_0611 - hypothetical protein (Protein is coded in complementary strand; from 67704 to 66571)