Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 6658342
End position: 6658365
Length: 24

DNA sequence
>NC_013929, from 6658342 to 6658365 (24 bp); Streptomyces scabiei 87.22 CCGCCGCCGGCGCCCCCGCCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6658201-6658992	Sequence	SCAB_59811 - hypothetical protein (Protein is coded in complementary strand; from 6658992 to 6658201)