Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 6696828
End position: 6696854
Length: 27

DNA sequence
>NC_013929, from 6696828 to 6696854 (27 bp); Streptomyces scabiei 87.22 CGCCTGTGGCGCCTGTGGCGCCCGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6696014-6697567	Sequence	SCAB_60101 - low complexity protein (Protein is coded in complementary strand; from 6697567 to 6696014)