Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 6697139
End position: 6697192
Length: 54

DNA sequence
>NC_013929, from 6697139 to 6697192 (54 bp); Streptomyces scabiei 87.22 CCGGTCTCCCCTCGGGGGCCGGTGTCGCCCCGGGGGCCGGTCTCACCTCTCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6696014-6697567	Sequence	SCAB_60101 - low complexity protein (Protein is coded in complementary strand; from 6697567 to 6696014)