Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 6869539
End position: 6869562
Length: 24

DNA sequence
>NC_013929, from 6869539 to 6869562 (24 bp); Streptomyces scabiei 87.22 GTGTCGGTGTCGGTGTCGGTGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6868131-6869579	Sequence	SCAB_62061 - major facilitator transporter (Protein is coded in complementary strand; from 6869579 to 6868131)