Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 694649
End position: 694708
Length: 60

DNA sequence
>NC_013929, from 694649 to 694708 (60 bp); Streptomyces scabiei 87.22 CGTGGGTCGGTCGTCTGTGGGGCGGTCGTCTGTGGGTCTGACGTCAGTGGGTCGGTCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 694311-694649	Sequence	SCAB_6251 - anti-anti-sigma-factor (Protein is coded in complementary strand; from 694649 to 694311)
ORF. 694646-696055	Sequence	SCAB_6261 - regulatory protein (Protein is coded in complementary strand; from 696055 to 694646)