Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 695508
End position: 695570
Length: 63

DNA sequence
>NC_013929, from 695508 to 695570 (63 bp); Streptomyces scabiei 87.22 CCTCGGCCTGTGCGCGCGCCTCTTCGGCCTGGGCTCGCGCTTGCTCGGCCTGTGCGCGCGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 694646-696055	Sequence	SCAB_6261 - regulatory protein (Protein is coded in complementary strand; from 696055 to 694646)