Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 7039143
End position: 7039166
Length: 24

DNA sequence
>NC_013929, from 7039143 to 7039166 (24 bp); Streptomyces scabiei 87.22 CATCGACATCGATATCGATATCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7038005-7039510	Sequence	SCAB_63511 - AMP-binding protein (Protein is coded in complementary strand; from 7039510 to 7038005)