Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 7047951
End position: 7047974
Length: 24

DNA sequence
>NC_013929, from 7047951 to 7047974 (24 bp); Streptomyces scabiei 87.22 CCGTCCCCGTCCCCGTCCCCGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7047876-7048895	Sequence	SCAB_63591 - hypothetical protein (Protein is coded in complementary strand; from 7048895 to 7047876)