Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 705939
End position: 705992
Length: 54

DNA sequence
>NC_013929, from 705939 to 705992 (54 bp); Streptomyces scabiei 87.22 TCCTCTCCGGCCGTGGCGTCCTCTTCGGCCGTGGCGTTCCCTCCGGCCGTGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 705750-707579	Sequence	SCAB_6391 - hydrolase (Protein is coded in complementary strand; from 707579 to 705750)