Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 7074442
End position: 7074465
Length: 24

DNA sequence
>NC_013929, from 7074442 to 7074465 (24 bp); Streptomyces scabiei 87.22 ACCGGCATCGGCATCGGCATCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7074208-7075896	Sequence	SCAB_63841 - aminotransferase (Protein is coded in complementary strand; from 7075896 to 7074208)