Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 7112846
End position: 7112872
Length: 27

DNA sequence
>NC_013929, from 7112846 to 7112872 (27 bp); Streptomyces scabiei 87.22 CGGAGGAGCCGGAGGAACCGGAGGAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7112404-7114248	Sequence	SCAB_64191 - serine-threonine protein kinase (Protein is coded in complementary strand; from 7114248 to 7112404)