Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 711747
End position: 711791
Length: 45

DNA sequence
>NC_013929, from 711747 to 711791 (45 bp); Streptomyces scabiei 87.22 GTGGCGGCCTCCGGGGCGGCGCCGTCCGGGAGGGCGGTCTCCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 710994-712061	Sequence	SCAB_6451 - hypothetical protein (Protein is coded in complementary strand; from 712061 to 710994)