Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 7202577
End position: 7202600
Length: 24

DNA sequence
>NC_013929, from 7202577 to 7202600 (24 bp); Streptomyces scabiei 87.22 CGAGGGCGACGGTGAGGGGGAGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7202218-7203357	Sequence	SCAB_65201 - peptidodoglycan-binding membrane protein (Protein is coded in complementary strand; from 7203357 to 7202218)