Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 7246954
End position: 7246977
Length: 24

DNA sequence
>NC_013929, from 7246954 to 7246977 (24 bp); Streptomyces scabiei 87.22 TGGGGGTGGGGGCGGGGGAGGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7246739-7247890	Sequence	SCAB_65571 - two-component sensor kinase (Protein is coded in complementary strand; from 7247890 to 7246739)