Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 7253157
End position: 7253219
Length: 63

DNA sequence
>NC_013929, from 7253157 to 7253219 (63 bp); Streptomyces scabiei 87.22 GCCCCGCGTGCACGCCGGTCGGCCCCGCGTGCGTGCCGGGCTGTCCTGTGTGCACGCCCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7251896-7253491	Sequence	SCAB_65621 - hypothetical protein (Protein is coded in complementary strand; from 7253491 to 7251896)