Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 7260898
End position: 7260924
Length: 27

DNA sequence
>NC_013929, from 7260898 to 7260924 (27 bp); Streptomyces scabiei 87.22 CCGGCACCCCCGGCACCACCGCCACCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7260793-7261611	Sequence	SCAB_65711 - regulator (Protein is coded in complementary strand; from 7261611 to 7260793)