Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 7312795
End position: 7312818
Length: 24

DNA sequence
>NC_013929, from 7312795 to 7312818 (24 bp); Streptomyces scabiei 87.22 GGGGCGGGTGCGGGCGCGGGGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7312745-7314025	Sequence	SCAB_66051 - two-component sensor kinase (Protein is coded in complementary strand; from 7314025 to 7312745)