Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 7336150
End position: 7336173
Length: 24

DNA sequence
>NC_013929, from 7336150 to 7336173 (24 bp); Streptomyces scabiei 87.22 AGCGCTCACGCGCTCACGCGCTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 7336164-7336832	Sequence	SCAB_66281 - heme oxygenase (Protein is coded in complementary strand; from 7336832 to 7336164)