Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 7390838
End position: 7390861
Length: 24

DNA sequence
>NC_013929, from 7390838 to 7390861 (24 bp); Streptomyces scabiei 87.22 ACCCTGGCCCTGGCCCTGGCCCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7389888-7391498	Sequence	SCAB_66761 - hypothetical protein (Protein is coded in complementary strand; from 7391498 to 7389888)