Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 7427079
End position: 7427102
Length: 24

DNA sequence
>NC_013929, from 7427079 to 7427102 (24 bp); Streptomyces scabiei 87.22 GCCGCCGTCGCCGCCGTCTCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7427055-7427864	Sequence	SCAB_67091 cobS cobalamin-5'-phosphate synthase (Protein is coded in complementary strand; from 7427864 to 7427055)