Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 7445641
End position: 7445667
Length: 27

DNA sequence
>NC_013929, from 7445641 to 7445667 (27 bp); Streptomyces scabiei 87.22 CTGGTCGGCCTGGTCGGCCCGGTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7444112-7445785	Sequence	SCAB_67251 - hypothetical protein (Protein is coded in complementary strand; from 7445785 to 7444112)