Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 7493846
End position: 7493875
Length: 30

DNA sequence
>NC_013929, from 7493846 to 7493875 (30 bp); Streptomyces scabiei 87.22 GCCCGGGAGGGACCGGAAGGGCCGGGGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7492991-7493929	Sequence	SCAB_67701 nfo endonuclease (Protein is coded in complementary strand; from 7493929 to 7492991)