Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 7508250
End position: 7508279
Length: 30

DNA sequence
>NC_013929, from 7508250 to 7508279 (30 bp); Streptomyces scabiei 87.22 TGTCGGTGTCGGTGTCGGTGTCGGTGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7508210-7509127	Sequence	SCAB_67841 - hypothetical protein (Protein is coded in complementary strand; from 7509127 to 7508210)