Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 7572791
End position: 7572814
Length: 24

DNA sequence
>NC_013929, from 7572791 to 7572814 (24 bp); Streptomyces scabiei 87.22 CGCGCCCTCGCCCGCACCGGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7572723-7573370	Sequence	SCAB_68391 hisH imidazole glycerol phosphate synthase subunit hisH