Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 7647836
End position: 7647871
Length: 36

DNA sequence
>NC_013929, from 7647836 to 7647871 (36 bp); Streptomyces scabiei 87.22 CACCGGCACCAGAACCGGCACCGCCACCCGCGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7646866-7649394	Sequence	SCAB_69041 - ATP-binding RNA helicase (Protein is coded in complementary strand; from 7649394 to 7646866)