Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 7788166
End position: 7788216
Length: 51

DNA sequence
>NC_013929, from 7788166 to 7788216 (51 bp); Streptomyces scabiei 87.22 CGGCACCTACGGCCTCACGGCACCTACGGCCTCACGGCACCTACGGCCTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 7788215-7789204	Sequence	SCAB_70331 - zinc-binding dehydrogenase (Protein is coded in complementary strand; from 7789204 to 7788215)