Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 7842259
End position: 7842282
Length: 24

DNA sequence
>NC_013929, from 7842259 to 7842282 (24 bp); Streptomyces scabiei 87.22 TCGGCGTTGGCGCCGGCGTCGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7841782-7842723	Sequence	SCAB_70811 - cobalamin biosynthesis protein (Protein is coded in complementary strand; from 7842723 to 7841782)