Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 7842733
End position: 7842762
Length: 30

DNA sequence
>NC_013929, from 7842733 to 7842762 (30 bp); Streptomyces scabiei 87.22 CGGATGCGGATGCGGATGCGGATGCGGATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7842720-7843277	Sequence	SCAB_70821 - CbiG-like cobalamin biosynthesis protein (Protein is coded in complementary strand; from 7843277 to 7842720)