Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 7848380
End position: 7848406
Length: 27

DNA sequence
>NC_013929, from 7848380 to 7848406 (27 bp); Streptomyces scabiei 87.22 GGCACCCCCGGCAACCCCGGCGCCCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7848374-7849900	Sequence	SCAB_70871 cobQ cobyric acid synthase (Protein is coded in complementary strand; from 7849900 to 7848374)