Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 7868390
End position: 7868413
Length: 24

DNA sequence
>NC_013929, from 7868390 to 7868413 (24 bp); Streptomyces scabiei 87.22 GTGCCGCCGAGCCGCCGGGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7867523-7869079	Sequence	SCAB_71091 - sodium:solute symporter (Protein is coded in complementary strand; from 7869079 to 7867523)