Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 7969645
End position: 7969671
Length: 27

DNA sequence
>NC_013929, from 7969645 to 7969671 (27 bp); Streptomyces scabiei 87.22 GCGGCCCAGCCGGCCCAGGCGGCCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7969198-7969722	Sequence	SCAB_72061 - hypothetical protein (Protein is coded in complementary strand; from 7969722 to 7969198)