Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 7977740
End position: 7977763
Length: 24

DNA sequence
>NC_013929, from 7977740 to 7977763 (24 bp); Streptomyces scabiei 87.22 GGCCGGTGCCGGTGCCGGGGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7977507-7978529	Sequence	SCAB_72141 - phosphatase (Protein is coded in complementary strand; from 7978529 to 7977507)