Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 7993243
End position: 7993266
Length: 24

DNA sequence
>NC_013929, from 7993243 to 7993266 (24 bp); Streptomyces scabiei 87.22 GTCAGCCCGTCAGCCCGTCAGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 7993261-7994343	Sequence	SCAB_72271 - hypothetical protein (Protein is coded in complementary strand; from 7994343 to 7993261)