Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 8010359
End position: 8010382
Length: 24

DNA sequence
>NC_013929, from 8010359 to 8010382 (24 bp); Streptomyces scabiei 87.22 GTGGTCGTGGTCGTGCTCGTGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 8009874-8011718	Sequence	SCAB_72421 - high-affinity transporter (Protein is coded in complementary strand; from 8011718 to 8009874)