Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 8051765
End position: 8051788
Length: 24

DNA sequence
>NC_013929, from 8051765 to 8051788 (24 bp); Streptomyces scabiei 87.22 GTCGACGTCGCCGTCGGCGTCGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 8050515-8051813	Sequence	SCAB_72791 - hypothetical protein (Protein is coded in complementary strand; from 8051813 to 8050515)