Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 8053130
End position: 8053156
Length: 27

DNA sequence
>NC_013929, from 8053130 to 8053156 (27 bp); Streptomyces scabiei 87.22 GGCCGTGGCCGCCGTGGCAGCCGTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 8051937-8053196	Sequence	SCAB_72801 - hypothetical protein (Protein is coded in complementary strand; from 8053196 to 8051937)