Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 8217662
End position: 8217685
Length: 24

DNA sequence
>NC_013929, from 8217662 to 8217685 (24 bp); Streptomyces scabiei 87.22 CCGCACCCGCACCCGCTCCGGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 8216881-8218167	Sequence	SCAB_74291 - hypothetical protein (Protein is coded in complementary strand; from 8218167 to 8216881)