Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 8418709
End position: 8418732
Length: 24

DNA sequence
>NC_013929, from 8418709 to 8418732 (24 bp); Streptomyces scabiei 87.22 CCCCGCCCCGGCACCCGCACCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 8418101-8420473	Sequence	SCAB_76171 - glycosyl hydrolase (Protein is coded in complementary strand; from 8420473 to 8418101)