Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 8588841
End position: 8588864
Length: 24

DNA sequence
>NC_013929, from 8588841 to 8588864 (24 bp); Streptomyces scabiei 87.22 TTCGGGTCCGGGTTCGGGTTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 8588767-8590155	Sequence	SCAB_77681 - MFS transporter (Protein is coded in complementary strand; from 8590155 to 8588767)