Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 8639000
End position: 8639047
Length: 48

DNA sequence
>NC_013929, from 8639000 to 8639047 (48 bp); Streptomyces scabiei 87.22 TCGACGGACCGATCGACGGACCGATCGACGGACCGATCGACGGACCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 8638982-8639914	Sequence	SCAB_78151 - ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 8639914 to 8638982)