Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 8654685
End position: 8654708
Length: 24

DNA sequence
>NC_013929, from 8654685 to 8654708 (24 bp); Streptomyces scabiei 87.22 GGCCGGGACCGGGGCGGGGGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 8654680-8655777	Sequence	SCAB_78351 - hypothetical protein (Protein is coded in complementary strand; from 8655777 to 8654680)